ADHDgene Database

Hot Results

Quick Search

Keyword:
Type:

Large-scale studies

Data Summary

Published Variant
- SNP: 1391
- CNV: 398
- Others: 173
Published Gene: 359
Published Region: 128
Pathway by PBA: 8
Study: 361

Study Report

Basic Info

Reference	Kent L, 200515940292
Citation	Kent L., Green E., Hawi Z., Kirley A., Dudbridge F., Lowe N., Raybould R., Langley K., Bray N., Fitzgerald M., Owen M. J., O'Donovan M. C., Gill M., Thapar A. and Craddock N. (2005) "Association of the paternally transmitted copy of common Valine allele of the Val66Met polymorphism of the brain-derived neurotrophic factor (BDNF) gene with susceptibility to ADHD." Mol Psychiatry, 10(10): 939-43.
Study Design	family-based
Study Type	Candidate-gene association study
Sample Size	341 probands and their parents
Predominant Ethnicity	Caucasian
Population	United Kingdom, Ireland
Gender	91% male
Age Group	Children/Adolescents : mean age=11.1 years; range 5-16 years; SD 2.8 years

Detail Info

Summary	The common Val66Met functional polymorphism in the human BDNF gene (rs 6265) was genotyped in a collaborative family-based sample of 341 white United Kingdom or Irish ADHD probands and their parents. They found evidence for preferential transmission of the valine (G) allele of BDNF with a strong paternal effect. Their findings support the hypothesis that BDNF is involved in the pathogenesis of ADHD. The transmission difference between parents raises the possibility that an epigenetic process may be involved.
Total Sample	For this study 341 ADHD probands and their parents were recruited from several child psychiatry clinics in the United Kingdom and Ireland. All 341 probands were white and born in the United Kingdom or Ireland (mean age=11.1 years; range 5-16 years; SD 2.8 years). The sample was predominantly male (91%) with no significant difference in sex ratio between the three study recruitment centres.
Sample Collection	For this study 341 ADHD probands and their parents were recruited from several child psychiatry clinics in the United Kingdom and Ireland.
Diagnosis Description	Parents were interviewed by trained psychiatrists or psychologists employing the Child and Adolescent Psychiatric Assessment (CAPA). Consistent interview procedures were employed across the three centres with researchers from each centre receiving a common training in the use of the CAPA. In addition, teacher ratings were obtained for 216 (63%) children by teacher telephone interview and the remaining 125 (37%) by the Conners Teacher Rating Scale (CTRS). All probands fulfilled DSM-IV diagnostic criteria for ADHD. Of these, 276 (81%) had ADHD combined type, 31 (9%) had the inattentive subtype and 34 (10%) had the hyperactive impulsive subtype.
Technique	High molecular weight genomic DNA was extracted from either whole blood or cheek swab according to routine procedures. The Val66Met (dsSNP rs 6265) polymorphism was genotyped by E Green in N Craddock's lab using a fluorescence polarizationbased primer extension assay, 21 using the Acyclo- Prime Kit (Perkin Elmer) according to the manufacturer's instructions and an analyst genotyping platform (LJL Biosystems). The following ampifluor primers were employed: allele-specific primer 1- 5'GAAGGTGACCAAGTTCATGCTCATCCAACAGCTC TTCTATCAC; allele-specific primer 2¨C5'GAAGGTC GGAGTCAACGGATTTCCTCATCCAACAGCTCTTCT ATCAT and reverse primer- 5'GGCTTGACATCAT TGGCTGACA. In order to verify genotyping accuracy, a subset of 100 samples was independently assayed (using either an alternative primer extension method or RFLP).
Analysis Method	The Transmission Disequilibrium Test (TDT) was used to test for the presence of nonrandom transmission of alleles to ADHD probands at the Val66Met polymorphism indicative of allelic association. TDTPHASE was used to test transmissions from fathers and mothers separately. The proportions of transmitted vs nontransmitted alleles between ADHD subtypes and comorbid groups were compared using X² tests.
Result Description	They found evidence for preferential transmission of the valine (G) allele of BDNF with a strong paternal effect. Their findings support the hypothesis that BDNF is involved in the pathogenesis of ADHD. The transmission difference between parents raises the possibility that an epigenetic process may be involved.

SNPs reported by this study (count: 1)

SNP	Allele Change	Risk Allele	Statistical Values	Author Comments	Result of Statistical Analysis
rs6265	Val/Met		TDT P-value=0.02, OR=1.61 for parental alleles; TDT P-value=1.00, OR=1.00 for maternal alleles; TDT P-value=0.0005, OR=3.2 for paternal alleles	there was significant overtransmission of the Val allele for...... there was significant overtransmission of the Val allele for the whole sample and separate parental transmissions; maternal transmissions alone demonstrated no bias but there was highly significant overtransmission of the Val allele from fathers More...	Significant

Genes reported by this study (count: 1)